description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTAAACAGTGACTTCCAAGATAACTATTATAAAAAAGTCCGGGCTCTCAGTCTCAACGCTGTGGACTTCCAAGACGCTGGCATATATTCTTGTGTGGCCAGCAATGATGTTGGCACACGCACGGCCACCATGAACTTCCAGGTGGTGGAGAGTGCCTACTTAAACTTGACCTCTGAGCAGAGCCTCTTGCAGGAGGTGTCTGTGGGTGACAGCCTCATCCTCACGGTCCATGCAGATGCCTACCCTAGCATACAGCATTACAACTGGACCTACCTAGGTCCATTCTTTGAAGACCAGCGCAAGCTTGAGTTTATCACCCAAAGGGCCATATACAGGTACACATTCAAGCTCTTTCTGAACCGTGTAAAGGCCTCAGAGGCGGGCCAGTACTTCTTAATGGCACAAAACAAGGCAGGCTGGAATAATCTGACCTTTGAGCTCACCCTGCGATATCCCCCAGAGGTCAGTGTTACATGGATGCCTGTGAATGGCTCTGATGTCCTGTTCTGTGACG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CSF1R(12978), Csf1r(12978)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Yang Gyun Kim et al.
PloS one, 10(9), e0137044-e0137044 (2015-09-09)
A proliferation-inducing ligand (APRIL) is a member of the tumor necrosis factor (TNF) superfamily. Despite advances in clinical and genetic studies, the details of the pathological roles of APRIL in IgA nephropathy (IgAN) remain to be fully defined. The present
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU174381-50UG | 04061828708673 |
| EMU174381-20UG | 04061828759842 |