description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGCCTAGTTCTGAGGAAGCATCGAATTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGCTCTGCACAGAGGCTGCCTCTCCTCGCCCTTCCTCTGAAGACCTGCCTCTTCAAGGCAGCCCTGATTCTTCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCCTGAGGAGGAGGAGAACAAGGTCCTTGCCAGGAAGCAGAAGATGCGGACTGTGTTCTCTCAGGCCCAGCTGTGTGCACTCAAGGACAGGTTTCAGAAGCAGAAGTACCTCAGCCTCCAGCAGATGCAAGAACTCTCCTCCATTCTGAACCTGAGCTATAAGCAGGTTAAGACCTGGTTTCAAAACCAAAGGATGAAGTGCAAGCGGTGGCAGAAAAACCAGTGGTTGAAGACTAGCAATGGTCTGATTCAGAAGGGCTCAGCACCAGTGGAGTATCCCAGCATCCATTGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... NANOG(71950), Nanog(71950)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Despina Bazou et al.
Ultrasound in medicine & biology, 37(2), 321-330 (2011-01-07)
In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Khalid Arif et al.
OncoTargets and therapy, 8, 1327-1334 (2015-06-18)
There is an accumulation of evidence that shows a significant role of cancer stem cells in tumor initiation, proliferation, relapse, and metastasis. Nanog is the most important core transcription marker of stem cells, known by its role in maintaining pluripotency
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU183581-20UG | 04061828763702 |
| EMU183581-50UG | 04061828713257 |