description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGATCAGATGGGAAAGATGAGACCTCAGCCGTATGGTGGGACTAACCCATACTCGCAACAACAGGGACCTCCTTCAGGACCGCAACAAGGACATGGGTACCCAGGGCAGCCATATGGGTCCCAGACTCCACAGCGGTACCCCATGACCATGCAGGGCCGGGCTCAGAGTGCCATGGGCAGCCTCTCTTATGCACAGCAGATTCCACCTTATGGCCAGCAAGGCCCCAGTGCGTATGGCCAGCAGGGCCAGACTCCATACTATAACCAGCAAAGTCCTCATCCCCAGCAGCAGCCACCTTACGCCCAGCAACCACCATCCCAGACCCCTCATGCCCAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ARID1A(93760), Arid1a(93760)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Xuxu Sun et al.
Cancer cell, 32(5), 574-589 (2017-11-15)
ARID1A, an SWI/SNF chromatin-remodeling gene, is commonly mutated in cancer and hypothesized to be tumor suppressive. In some hepatocellular carcinoma patients, ARID1A was highly expressed in primary tumors but not in metastatic lesions, suggesting that ARID1A can be lost after
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU177361-20UG | 04061828761487 |
| EMU177361-50UG | 04061828710409 |