description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGAACTGCCAAAGCACATCTACAACAAGTTAGATAAAGGACAAATCATAGTGGTGATTTGGGTAATAGTCTCTCCAAACAACGACAAGCAGAAGTACACTCTGAAGATCAATCATGACTGTGTGCCAGAGCAAGTCATTGCTGAAGCCATCAGGAAAAAGACTCGGAGCATGTTGTTGTCCTCTGAGCAGCTGAAACTCTGTGTCTTAGAATATCAGGGCAAGTATATTCTGAAAGTGTGTGGCTGTGACGAATACTTCCTGGAAAAGTACCCTCTGAGTCAGTACAAGTACATAAGAAGCTGTATAATGCTGGGGAGGATGCCCAACTTGATGCTGATGGCCAAAGAAAGCCTATACTCTCAGCTGCCGATTGATAGCTTCACCATGCCGTCATACTCCAGGCGCATCTCCACAGCCACACCCTACATGAATGGAGAGACATCTACGAAATCCCTCTGGGTCATA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PIK3CA(18706), Pik3ca(18706)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU053821-20UG | 04061828466542 |
| EMU053821-50UG | 04061831369601 |