description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCAGAAGTGCGAAGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCCCTGGAGCCCCTGAAGAAGAGCCGCCTGCAGCTGCTGGGGGCCACCTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATTCCCTTGACTGCCGAGAAGTTGTGCATCTACACTGACAACTCTATCCGGCCCGAGGAGCTGCTGCAAATGGAACTGCTTCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCCATGACTCCCCACGATTTCATCGAACACTTCCTCTCCAAAATGCCAGAGGCGGATGAGAACAAGCAGACCATCCGCAAGCATGCACAGACCTTTGTGGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAACCCACCCTCCATGGTAGCTGCTGGGAGCGTGGTGGCTGCGATGCAAGGCCTGAACCTGGGCAGCCCCAACAACTTCCTCTCCTGCTACCGCACAACGCACTTTCTTTCCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CCND1(12443), Ccnd1(12443)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
B St Croix et al.
The Journal of cell biology, 142(2), 557-571 (1998-07-29)
Recent studies have demonstrated the importance of E-cadherin, a homophilic cell-cell adhesion molecule, in contact inhibition of growth of normal epithelial cells. Many tumor cells also maintain strong intercellular adhesion, and are growth-inhibited by cell- cell contact, especially when grown
Ali Rihani et al.
Cancer cell international, 15, 76-76 (2015-08-01)
Neuroblastoma is a neural crest-derived tumor and is the most common cancer in children less than 1 year of age. We hypothesized that aberrations in genes that control the cell cycle could play an important role in the pathogenesis of neuroblastoma
Wei Xing et al.
Journal of dermatological science, 79(2), 101-109 (2015-06-08)
Acemannan is a bioactive polysaccharides promoting tissue repair. However, the roles of acemannan in skin wound healing and the underlying molecular mechanisms are largely unclear. The goal of this study is to investigate the positive role of acemannan in cutaneous
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU036931-50UG | 04061828271832 |
| EMU036931-20UG | 04061828497058 |