description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTTCTTTTAGCCATGTAGAAACTCTAAATTAAGCCAATATTCTCATTTGAGAATGAGGATGTCTCAGCTGAGAAACGTTTTAAATTCTCTTTATTCATAATGTTCTTTGAAGGGTTTAAAACAAGATGTTGATAAATCTAAGCTGATGAGTTTGCTCAAAACAGGAAGTTGAAATTGTTGAGACAGGAATGGAAAATATAATTAATTGATACCTATGAGGATTTGGAGGCTTGGCATTTTAATTTGCAGATAATACCCTGGTAATTCTCATGAAAAATAGACTTGGATAACTTTTGATAAAAGACTAATTCCAAAATGGCCACTTTGTTCCTGTCTTTAATATCTAAATACTTACTGAGGTCCTCCATCTTCTATATTATGAATTTTCATTTATTAAGCAAATGTCATATTACCTTGAAATTCAGAAGAGAAGAAACATATACTGTGTCCAGAGTATAATGAACCTGCAGAGTTGTGCTTCTTACTGCTAATTCTGGGAGCTTTCACAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
wgk
WGK 1
Sha Liu et al.
Cancer medicine, 6(4), 819-833 (2017-03-24)
We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR
Atsuko Ogino et al.
Molecular oncology, 15(1), 27-42 (2020-03-20)
Small-cell lung cancer (SCLC) occurs infrequently in never/former light smokers. We sought to study this rare clinical subset through next-generation sequencing (NGS) and by characterizing a representative patient-derived model. We performed targeted NGS, as well as comprehensive pathological evaluation, in
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU224041-50UG | 04061828728534 |
| EHU224041-20UG | 04061831390810 |