설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTTCTTTTAGCCATGTAGAAACTCTAAATTAAGCCAATATTCTCATTTGAGAATGAGGATGTCTCAGCTGAGAAACGTTTTAAATTCTCTTTATTCATAATGTTCTTTGAAGGGTTTAAAACAAGATGTTGATAAATCTAAGCTGATGAGTTTGCTCAAAACAGGAAGTTGAAATTGTTGAGACAGGAATGGAAAATATAATTAATTGATACCTATGAGGATTTGGAGGCTTGGCATTTTAATTTGCAGATAATACCCTGGTAATTCTCATGAAAAATAGACTTGGATAACTTTTGATAAAAGACTAATTCCAAAATGGCCACTTTGTTCCTGTCTTTAATATCTAAATACTTACTGAGGTCCTCCATCTTCTATATTATGAATTTTCATTTATTAAGCAAATGTCATATTACCTTGAAATTCAGAAGAGAAGAAACATATACTGTGTCCAGAGTATAATGAACCTGCAGAGTTGTGCTTCTTACTGCTAATTCTGGGAGCTTTCACAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NRAS(4893), NRAS(4893)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Sha Liu et al.
Cancer medicine, 6(4), 819-833 (2017-03-24)
We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR
Atsuko Ogino et al.
Molecular oncology, 15(1), 27-42 (2020-03-20)
Small-cell lung cancer (SCLC) occurs infrequently in never/former light smokers. We sought to study this rare clinical subset through next-generation sequencing (NGS) and by characterizing a representative patient-derived model. We performed targeted NGS, as well as comprehensive pathological evaluation, in
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Matthew E Welsch et al.
Cell, 168(5), 878-889 (2017-02-25)
Design of small molecules that disrupt protein-protein interactions, including the interaction of RAS proteins and their effectors, may provide chemical probes and therapeutic agents. We describe here the synthesis and testing of potential small-molecule pan-RAS ligands, which were designed to interact
Sushmita Chakraborty et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3852-3860 (2015-03-20)
Leishmania major is a parasite that resides and replicates in macrophages. We previously showed that the parasite enhanced CD40-induced Raf-MEK-ERK signaling but inhibited PI3K-MKK-p38MAPK signaling to proleishmanial effects. As Raf and PI3K have a Ras-binding domain but exert opposite effects
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.