description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGCATGAGAACAACTGGATCTGCATCCAGGAGGACACCGGCCTCCTCTACCTTAACCGGAGCCTGGACCATAGCTCCTGGGAGAAGCTCAGTGTCCGCAACCGCGGCTTTCCCCTGCTCACCGTCTACCTCAAGGTCTTCCTGTCACCCACATCCCTTCGTGAGGGCGAGTGCCAGTGGCCAGGCTGTGCCCGCGTATACTTCTCCTTCTTCAACACCTCCTTTCCAGCCTGCAGCTCCCTCAAGCCCCGGGAGCTCTGCTTCCCAGAGACAAGGCCCTCCTTCCGCATTCGGGAGAACCGACCCCCAGGCACCTTCCACCAGTTCCGCCTGCTGCCTGTGCAGTTCTTGTGCCCCAACATCAGCGTGGCCTACAGGCTCCTGGAGGGTGAGGGTCTGCCCTTCCGCTGCGCCCCGGACAGCCTGGAGGTGAGCACGCGCTGGGCCCTGGACCGCGAGCAGCGGGAGAAGTACGAGCTGGTGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Kaustubh Bhinge et al.
Oncotarget, 8(16), 27155-27165 (2017-05-04)
Achaete-scute homolog 1 (ASCL1) is a neuroendocrine transcription factor specifically expressed in 10-20% of lung adenocarcinomas (AD) with neuroendocrine (NE) differentiation (NED). ASCL1 functions as an upstream regulator of the RET oncogene in AD with high ASCL1 expression (A+AD). RET
N Narita et al.
Oncogene, 28(34), 3058-3068 (2009-06-30)
RET proto-oncogene encodes a receptor tyrosine kinase whose ligand is glial cell line-derived neurotrophic factor (GDNF), and its polymorphism at G691S juxtamembrane region (RETp) is a germline polymorphism. Cutaneous melanomas, particularly the desmoplastic subtype, are highly neurotropic; thus we sought
Hoon Ryu et al.
Laboratory investigation; a journal of technical methods and pathology, 91(3), 342-352 (2011-02-02)
Amyotrophic lateral sclerosis (ALS) is a fatal neurological disorder characterized by selective degeneration of motor neurons throughout the central nervous systems. Non-cell autonomous damage induced by glial cells is linked to the selective susceptibility of motor neurons in ALS, but
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU161031-20UG | 04061828657896 |
| EHU161031-50UG | 04061831376630 |