description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTCATCAATGCAGCCAAGATCATCCGCCACCCCAAATACAACAGCCGGACTCTGGACAATGACATCCTGCTGATCAAGCTCTCCTCACCTGCCGTCATCAATTCCCGCGTGTCCGCCATCTCTCTGCCCACTGCCCCTCCAGCTGCTGGCACCGAGTCCCTCATCTCCGGCTGGGGCAACACTCTGAGTTCTGGTGCCGACTACCCAGACGAGCTGCAGTGCCTGGATGCTCCTGTGCTGAGCCAGGCTGAGTGTGAAGCCTCCTACCCTGGAAAGATTACCAACAACATGTTCTGTGTGGGCTTCCTCGAGGGAGGCAAGGATTCCTGCCAGGGTGATTCTGGTGGCCCTGTGGTCTCCAATGGAGAGCTCCAAGGAATTGTCTCCTGGGGCTATGGCTGTGCCCAGAAGAACAGGCCTGGAGTCTACACCAAGGTCTACAACTATGTGGACTGGATTAAGGACACCATAGCTGCCAAC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Arnaud Cheuk et al.
BMC plant biology, 20(1), 144-144 (2020-04-09)
Drought stress is one of the major factors limiting wheat production globally. Improving drought tolerance is important for agriculture sustainability. Although various morphological, physiological and biochemical responses associated with drought tolerance have been documented, the molecular mechanisms and regulatory genes
Laura Rinaldi et al.
Nature communications, 10(1), 2572-2572 (2019-06-14)
Activation of G-protein coupled receptors elevates cAMP levels promoting dissociation of protein kinase A (PKA) holoenzymes and release of catalytic subunits (PKAc). This results in PKAc-mediated phosphorylation of compartmentalized substrates that control central aspects of cell physiology. The mechanism of
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU118341-20UG | 04061828552313 |
| EHU118341-50UG | 04061828316885 |