description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAACCTGTCAGCATTGAAGGAACTCTCACCTCCGTGGGCCTGAAATGCTTGGGAGTTGATGGAACCAAATAGAAAAACTCCATGTTCTGCATGTAAGAAACACAATGCCTTGCCCTACTCAGACCTGATAGGATTGCCTGCTTAGATGATAAAATGAGGCAGAATATGTCTGAAGAAAAAAATTGCAAGCCACACTTCTAGAGATTTTGTTCAAGATCATTTCAGGTGAGCAGTTAGAGTAGGTGAATTTGTTTCAAATTGTACTAGTGACAGTTTCTCATCATCTGTAACTGTTGAGATGTATGTGCATGTGACCACAAATGCTTGCTTGGACTTGCCCATCTAGCACTTTGGAAATCAGTATTTAAATGCCAAATAATCTTCCAGGTAGTGCTGCTTCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Leon Caly et al.
Biochemical and biophysical research communications, 483(1), 64-68 (2017-01-08)
Respiratory syncytial virus (RSV) is a major cause of respiratory infections in infants and the elderly, leading to more deaths than influenza each year worldwide. With no RSV antiviral or efficacious vaccine currently available, improved understanding of the host-RSV interaction
Takouhie Mgrditchian et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(44), E9271-E9279 (2017-10-29)
While blocking tumor growth by targeting autophagy is well established, its role on the infiltration of natural killer (NK) cells into tumors remains unknown. Here, we investigate the impact of targeting autophagy gene Beclin1 (BECN1) on the infiltration of NK
Ting Li et al.
Acta pharmacologica Sinica, 36(12), 1503-1513 (2015-11-26)
Platycodin D, the main saponin isolated from Chinese herb Platycodonis Radix, exhibits anticancer activities against various cancer cell lines. Here we evaluated its anticancer action against human hepatocellular carcinoma cells in vitro and in vivo, and elucidated the relationship between
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU080681-20UG | 04061831353792 |
| EHU080681-50UG | 04061828403943 |