description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGATTCCCGGACAGACATTACCTCTTCAGCTTTTTCACCCTCAAGAAGTCAGTATGGTGCGGAATTTAATTCAGAAAGATAGAACCTTTGCTGTTCTTGCATACAGCAATGTACAGGAAAGGGAAGCACAGTTTGGAACAACAGCAGAGATATATGCCTATCGAGAAGAACAGGATTTTGGAATTGAGATAGTGAAAGTGAAAGCAATTGGAAGACAAAGGTTCAAAGTCCTTGAGCTAAGAACACAGTCAGATGGAATCCAGCAAGCTAAAGTGCAAATTCTTCCCGAATGTGTGTTGCCTTCAACCATGTCTGCAGTTCAATTAGAATCCCTCAATAAGTGCCAGATATTTCCTTCAAAACCTGTCTCAAGAGAAGACCAATGTTCATATAAATGGTGGCAGAAATACCAGAAGAGAAAGTTTCATTGTGCAAATCTAACTTCATGGCCTCGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Longchuan Bai et al.
Cancer cell, 36(5), 498-511 (2019-11-13)
Signal transducer and activator of transcription 3 (STAT3) is an attractive cancer therapeutic target. Here we report the discovery of SD-36, a small-molecule degrader of STAT3. SD-36 potently induces the degradation of STAT3 protein in vitro and in vivo and demonstrates high
Hyunji Moon et al.
Nature communications, 11(1), 5489-5489 (2020-11-01)
Calcium flux regulating intracellular calcium levels is essential and modulated for efficient efferocytosis. However, the molecular mechanism by which calcium flux is modulated during efferocytosis remains elusive. Here, we report that Orai1, a Crbn substrate, is upregulated via its attenuated
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU047571-50UG | 04061828320882 |
| EHU047571-20UG | 04061831343014 |