description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGCAAGAAGGGAAAGTTGCCCATTGTAAATGAAGATGATGAGCTTGTGGCCATCATTGCCCGGACAGACCTGAAGAAGAATCGGGACTACCCACTAGCCTCCAAAGATGCCAAGAAACAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAGGATGACAAGTATAGGCTGGACTTGCTCGCCCAGGCTGGTGTGGATGTAGTGGTTTTGGACTCTTCCCAGGGAAATTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGACAAATACCCTAATCTCCAAGTCATTGGAGGCAATGTGGTCACTGCTGCCCAGGCCAAGAACCTCATTGATGCAGGTGTGGATGCCCTGCGGGTGGGCATGGGAAGTGGCTCCATCTGCATTACGCAGGAAGTGCTGGCCTGTGGGCGGCCCCAAGCAACAGCAGTGTACAAGGTGTCAGAGTATGCACGGCGCTTTGGTGTTCCGGTCATTGCTGAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Anna Bianchi-Smiraglia et al.
Nature methods, 14(10), 1003-1009 (2017-09-05)
GTP is a major regulator of multiple cellular processes, but tools for quantitative evaluation of GTP levels in live cells have not been available. We report the development and characterization of genetically encoded GTP sensors, which we constructed by inserting
Gerson Dierley Keppeke et al.
Cell division, 13, 5-5 (2018-06-28)
Inosine monophosphate dehydrogenase (IMPDH), the rate-limiting enzyme in de novo GTP biosynthesis, plays an important role in cell metabolism and proliferation. It has been demonstrated that IMPDH can aggregate into a macrostructure, termed the cytoophidium, in mammalian cells under a
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU027541-20UG | 04061828576814 |
| EHU027541-50UG | 04061828341412 |