description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCACCGTCACTCTCAAGGATCTCCGTGTAGAACTCCTTGGAGAGACCTCTATTGCTGAGTGCTTGACATACCTTGATAATGGTGTTGTGTTTGTCGGGTCTCGCCTGGGTGACTCCCAGCTTGTGAAGCTCAACGTTGACAGTAATGAACAAGGCTCCTATGTAGTGGCCATGGAAACCTTTACCAACTTAGGACCCATTGTCGATATGTGCGTGGTGGACCTGGAGAGGCAGGGGCAGGGGCAGCTGGTCACTTGCTCTGGGGCTTTCAAGGAAGGTTCTTTGCGGATCATCCGGAATGGAATTGGAATCCACGAGCATGCCAGCATTGACTTACCAGGCATCAAAGGATTATGGCCACTGCGGTCTGACCCTAATCGTGAGACTGATGACACTTTGGTGCTCTCTTTTGTGGGCCAGACAAGAGTTCTCATGTTAAATGGAGAGGAGGTAGAAGAAACCGAACTGATGGGTTTCGTGGATGATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Huiming Lu et al.
Nature communications, 8(1), 2039-2039 (2017-12-13)
Pathway choice within DNA double-strand break (DSB) repair is a tightly regulated process to maintain genome integrity. RECQL4, deficient in Rothmund-Thomson Syndrome, promotes the two major DSB repair pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). Here we report
Hiroaki Kawara et al.
Biochemical and biophysical research communications, 519(1), 204-210 (2019-09-09)
The ERCC1-XPF heterodimer is a structure-specific endonuclease and plays multiple roles in various DNA repair pathways including nucleotide excision repair and also telomere maintenance. The dimer formation, which is mediated by their C-terminal helix-hairpin-helix regions, is essential for their endonuclease
Qiuling Li et al.
The Journal of biological chemistry, 290(35), 21553-21567 (2015-07-15)
Pygopus 2 (Pygo2/PYGO2) is an evolutionarily conserved coactivator and chromatin effector in the Wnt/β-catenin signaling pathway that regulates cell growth and differentiation in various normal and malignant tissues. Although PYGO2 is highly overexpressed in a number of human cancers, the
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU027341-20UG | 04061828576647 |
| EHU027341-50UG | 04061828341214 |