description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGATACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGAAGATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAATGTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGGAATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACGTGCTTGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATCATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGATGGCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTCATATGGAATATTACTGTGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGCATTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Rui-Fang Dong et al.
Gene, 697, 152-158 (2019-02-18)
Neuron damage contributes to ischemic brain injury. Although FMS-like tyrosine kinase-3 (FLT3) plays a critical role in neuron survival, its function and molecular mechanism in cerebral ischemia/reperfusion injury is unclear. In the present study, we exposed SH-SY5Y cells to oxygen
Anna Skwarska et al.
Biochemical pharmacology, 95(4), 238-252 (2015-04-22)
Drugs targeting receptor tyrosine kinase FLT3 are of particular interest since activating FLT3-internal tandem duplication (ITD) mutations abundantly occur in fatal acute myeloid leukemias (AMLs). Imidazoacridinone C-1311, a DNA-reactive inhibitor of topoisomerase II, has been previously shown to be a
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU020691-50UG | 04061828340644 |
| EHU020691-20UG | 04061831340310 |