description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTACAAGGCTGCGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATCGATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTCCGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGACAAGAACAACGACGGCCGCATCGACTATGATGAGTTCCTGGAGTTCATGAAGGGTGTGGAGTAGATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCCAACTCCAGCTGAGTCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Juan L Vivero-Escoto et al.
Journal of materials chemistry. B, 7(46), 7396-7405 (2019-11-09)
Chronic liver dysfunction often begins with hepatic fibrosis. A pivotal event in the progression of liver fibrosis and cirrhosis is hepatic stellate cell (HSC) activation and secretion of extracellular matrix proteins, including tenascin-C (TnC). TnC is often chosen as a
Elena Jachetti et al.
Cancer research, 75(10), 2095-2108 (2015-03-27)
Precociously disseminated cancer cells may seed quiescent sites of future metastasis if they can protect themselves from immune surveillance. However, there is little knowledge about how such sites might be achieved. Here, we present evidence that prostate cancer stem-like cells
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU009031-20UG | 04061828678945 |
| EHU009031-50UG | 04061828455621 |