description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTGCATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAACTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATTTGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATCTTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCCAAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTATGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Bin Zhang et al.
Cancer letters, 459, 204-215 (2019-06-15)
Macrophage-targeted therapy offers new options for intractable pancreatic ductal adenocarcinoma (PDAC), which has a low 5-year survival rate. However, the factors regulating the biological function and phenotype of macrophages in PDAC are incompletely understood. Here, we found that CD51 was
Chuyue Zhang et al.
ACS nano, 14(9), 12133-12147 (2020-08-14)
Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-EVs) have been recognized as a promising cell-free therapy for acute kidney injury (AKI), which avoids safety concerns associated with direct cell engraftment. However, low stability and retention of MSC-EVs have limited
Huashe Wang et al.
Pathology, research and practice, 215(9), 152531-152531 (2019-07-20)
Integrin subunit alpha V (ITGAV), a member of integrin family of extracellular matrix receptors, is involved in many types of cancer. In this study, the expression levels, clinical features and prognosis of ITGAV in gastric cancer (GC) patients were investigated
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EHU002301-50UG | 04061828443154 |
| EHU002301-20UG | 04061828657216 |