Skip to Content
MilliporeSigma

EMU063711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccl2

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCAGCCAACTCTCACTGAAGCCAGCTCTCTCTTCCTCCACCACCATGCAGGTCCCTGTCATGCTTCTGGGCCTGCTGTTCACAGTTGCCGGCTGGAGCATCCACGTGTTGGCTCAGCCAGATGCAGTTAACGCCCCACTCACCTGCTGCTACTCATTCACCAGCAAGATGATCCCAATGAGTAGGCTGGAGAGCTACAAGAGGATCACCAGCAGCAGGTGTCCCAAAGAAGCTGTAGTTTTTGTCACCAAGCTCAAGAGAGAGGTCTGTGCTGACCCCAAGAAGGAATGGGTCCAGACATACATTAAAAACCTGGATCGGAACCAAATGAGATCAGAACCTACAACTTTATTTAAAACTGCATCTGCCCTAAGGTCTTCAGCACCTTTGAATGTGAAGTTGACCCG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Su Chen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 5881-5890 (2015-03-07)
Both intra-tumor macrophage and T-box transcription factor Brachyury (T) have been proved to play important roles in tumor progression and metastasis. However, it is still unknown whether T could regulate the infiltration of macrophages. Here, we report that the Brachyury
Nan Che et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5306-5314 (2014-10-24)
Mesenchymal stem cells (MSC) from healthy human and normal mice can inhibit normal B cell proliferation, differentiation, and Ab secretion in vitro. However, it remains unknown whether MSC from lupus-like mice and patients with systemic lupus erythematosus (SLE) exhibit the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service