Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCAATGTGGGGCTTGATTTCACCTGGCACTCTCCACCTTCAAAGTCTCATCATAAGAAGATTGTAAACCGGGATGTGAAACCCTTTCCTGGGACTGTGGCGAAGATGTTTTTGAGCACCTTGACAATAGAAAGTGTGACCAAGAGTGACCAAGGGGAATACACCTGTGTAGCGTCCAGTGGACGGATGATCAAGAGAAATAGAACATTTGTCCGAGTTCACACAAAGCCTTTTATTGCTTTCGGTAGTGGGATGAAATCTTTGGTGGAAGCCACAGTGGGCAGTCAAGTCCGAATCCCTGTGAAGTATCTCAGTTACCCAGCTCCTGATATCAAATGGTACAGAAATGGAAGGCCCATTGAGTCCAACTACACAATGATTGTTGGCGATGAACTCACCATCATGGAAGTGACTGAAAGAGATGCAGGAAACTACACGGTCATCCTCACCAA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... KDR(16542), Kdr(16542)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ming-Heng Wu et al.
Angiogenesis, 17(4), 839-849 (2014-04-11)
Galectin-1 (Gal-1) is a β-galactoside-binding lectin that regulates endothelial cell migration, proliferation, and adhesion. However, the effect of Gal-1 on vascular permeability and the underlying mechanisms are unclear. We found that high Gal-1 expression was associated with elevated tumor vascular
Dongshi Chen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3472-3484 (2014-04-26)
Regorafenib, a multikinase inhibitor targeting the Ras/Raf/MEK/ERK pathway, has recently been approved for the treatment of metastatic colorectal cancer. However, the mechanisms of action of regorafenib in colorectal cancer cells have been unclear. We investigated how regorafenib suppresses colorectal cancer
Richard P Hulse et al.
Clinical science (London, England : 1979), 129(8), 741-756 (2015-07-23)
Diabetic peripheral neuropathy affects up to half of diabetic patients. This neuronal damage leads to sensory disturbances, including allodynia and hyperalgesia. Many growth factors have been suggested as useful treatments for prevention of neurodegeneration, including the vascular endothelial growth factor
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU052221-20UG | 04061831347982 |
| EMU052221-50UG | 04061828286416 |