Skip to Content
MilliporeSigma

EMU005531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGGATTGCACCCATAATCTGGGCTGAATCATGAAAGGGTGTTCCTCTTATCTAATGTACTCCTTTGGGGGACTTTTGTCCCTATGGATTCTTCTGGTGTCTTCCACAAACCAATGCACTGTGAGATACAACGTAGCTGACTGCAGCCATTTGAAGCTAACACACATACCTGATGATCTTCCCTCTAACATAACAGTGTTGAATCTTACTCACAACCAACTCAGAAGATTACCACCTACCAACTTTACAAGATACAGCCAACTTGCTATCTTGGATGCAGGATTTAACTCCATTTCAAAACTGGAGCCAGAACTGTGCCAAATACTCCCTTTGTTGAAAGTATTGAACCTGCAACATAATGAGCTCTCTCAGATTTCTGATCAAACCTTTGTCTTCTGCACGAACCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
K Mori et al.
Journal of dental research, 94(8), 1149-1157 (2015-06-06)
Damage-associated molecular patterns (DAMPs), endogenous molecules released from injured or dying cells, evoke sterile inflammation that is not induced by microbial pathogens. Periodontal diseases are infectious diseases caused by oral microorganisms; however, in some circumstances, DAMPs might initiate inflammatory responses
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
A I Kajita et al.
The Journal of investigative dermatology, 135(8), 2005-2011 (2015-03-31)
Toll-like receptors (TLRs) recognize specific microbial products in the innate immune response. TLR3, a double-stranded RNA sensor, is thought to have an important role in viral infections, but the regulation of TLR3 expression and its function in keratinocytes are not

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service