EHU900901
MISSION® esiRNA
targeting human PDGFB
Select a Size
About This Item
form
lyophilized
lyophilized powder
esiRNA cDNA target sequence
TACCTCCACCCTGCATTTTCCTCTTGTCCTGGCCCTTCAGTCTGCTCCACCAAGGGGCTCTTGAACCCCTTATTAAGGCCCCAGATGATCCCAGTCACTCCTCTCTAGGGCAGAAGACTAGAGGCCAGGGCAGCAAGGGACCTGCTCATCATATTCCAACCCAGCCACGACTGCCATGTAAGGTTGTGCAGGGTGTGTACTGCACAAGGACATTGTATGCAGGGAGCACTGTTCACATCATAGATAAAGCTGATTTGTATATTTATTATGACAATTTCTGGCAGATGTAGGTAAAGAGGAAAAGGATCCTTTTCCTAAT
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PDGFB(5155)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
11 - Combustible Solids
wgk_germany
WGK 1
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service