Skip to Content
MilliporeSigma

EHU222801

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCCTGTTCAACACCCTCTTCATGAATGCTGCCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCATGACCATTCTGCTCATCGTCATCCCAGTGCTGATCTTCCAGGCCTATGGATAGATCAGGAGGCATCACTGAGGCCAGGAGCTCTGCCCATGACCTGTATCCCACGTACTCCAACTTCCATTCCTCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IFITM3(10410)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Robert A Campbell et al.
Blood, 133(19), 2013-2026 (2019-02-07)
Evolving evidence indicates that platelets and megakaryocytes (MKs) have unexpected activities in inflammation and infection; whether viral infections upregulate biologically active, antiviral immune genes in platelets and MKs is unknown, however. We examined antiviral immune genes in these cells in
Yiming Liang et al.
Oncology reports, 40(6), 3261-3272 (2018-10-03)
The interferon-induced transmembrane protein 3 (IFITM3, also called 1‑8U) gene represents dysregulated expression in various tumors and is involved in tumorigenesis and progression. However, the role of IFITM3 and its underlying mechanism in hepatocellular carcinoma (HCC) are still far from elucidated.
Alexander Kühnl et al.
mBio, 9(4) (2018-07-26)
To transfer the viral genome into the host cell cytoplasm, internalized influenza A virus (IAV) particles depend on the fusion of the IAV envelope with host endosomal membranes. The antiviral host interferon (IFN) response includes the upregulation of interferon-induced transmembrane
Milene Mesquita et al.
PloS one, 9(6), e101056-e101056 (2014-07-01)
HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle
Nicholas M Chesarino et al.
PLoS pathogens, 11(8), e1005095-e1005095 (2015-08-12)
Interferon (IFN)-induced transmembrane protein 3 (IFITM3) is a cell-intrinsic factor that limits influenza virus infections. We previously showed that IFITM3 degradation is increased by its ubiquitination, though the ubiquitin ligase responsible for this modification remained elusive. Here, we demonstrate that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service