Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTGGGGAGCTCAGAACATCCCCCAATCTCTTACAGCTCCCTCCCCAAAACTGGGGTCCCAGCAACCCTGGCCCCCAACCCCAGCAAATCTCTAACACCTCCTAGAGGCCAAGGCTTAAACAGGCATCTCTACCAGCCCCACTGTCTCTAACCACTCCTGGGCTAAGGAGTAACCTCCCTCATCTCTAACTGCCCCCACGGGGCCAGGGCTACCCCAGAACTTTTAACTCTTCCAGGACAGGGAGCTTCGGGCCCCCACTCTGTCTCCTGCCCCCGGGGGCCTGTGGCTAAGTAAACCATACCTAACCTACCCCAGTGTGGGTGTGGGCCTCTGAATATAACCCACACCCAGCGTAGGGGGAGTCTGAGCCGGGAGGGCTCCCGAGTCTCTGCCTTCAGCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Inhibition of SIRT2 Alleviates Fibroblast Activation and Renal Tubulointerstitial Fibrosis via MDM2.
Fang-Fang He et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 451-460 (2018-04-04)
Renal tubular epithelial cells and fibroblasts are the main sources of myofibroblasts, and these cells produce the extracellular matrix during tubulointerstitial fibrosis (TIF). Histone deacetylases (HDAC) inhibitors exert an antifibrogenic effect in the skin, liver and lung. Sirtuin 2 (SIRT2)
Chin-Wei Liu et al.
Chemico-biological interactions, 289, 98-108 (2018-04-22)
Breast cancer is a major public health problem throughout the world. In this report, we investigated whether CHM-1, a novel synthetic antimitotic agent could be developed into a potent antitumor agent for treating human breast cancer. CHM-1 induced growth inhibition
Phuongmai Nguyen et al.
Radiation research, 191(5), 398-412 (2019-03-06)
Sirtuin 2 (SIRT2) plays a major role in aging, carcinogenesis and neurodegeneration. While it has been shown that SIRT2 is a mediator of stress-induced cell death, the mechanism remains unclear. In this study, we report the role of SIRT2 in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU160521-20UG | 04061828657483 |
| EHU160521-50UG | 04061828431632 |