Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGAAATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATATATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGTTTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGAAACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fang Zheng et al.
Experimental & molecular medicine, 50(9), 121-121 (2018-09-14)
β-Elemene, an active component of natural plants, has been shown to exhibit anticancer properties. However, the detailed mechanism underlying these effects has yet to be determined. In this study, we show that β-elemene inhibits the growth of lung cancer cells.
Hideno Tochigi et al.
Scientific reports, 7, 40001-40001 (2017-01-05)
Endometrial decidualization represents an essential step for the successful implantation of the embryo; however, the molecular mechanism behind this differentiation process remains unclear. This study aimed to identify novel microRNAs (miRNAs) involved in the regulation of decidual gene expression in
Ali Vaziri-Gohar et al.
Molecular and cellular endocrinology, 422, 160-171 (2015-12-23)
Tamoxifen, a selective estrogen receptor modulator, is a commonly prescribed adjuvant therapy for estrogen receptor-α (ERα)-positive breast cancer patients. To determine if extracellular factors contribute to the modulation of IGF-1 signaling after tamoxifen treatment, MCF-7 cells were treated with IGF-1 in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU131401-20UG | 04061831363975 |
| EHU131401-50UG | 04061828458233 |