Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGAGTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCCGGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGTATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGACACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCCCTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qinghong Qin et al.
Oncology letters, 16(5), 5591-5598 (2018-10-23)
Polymerase δ catalytic subunit gene 1 (POLD1) may serve an important function in the development of tumors. However, its role in breast cancer remains unclear. The aim of the present study was to observe the expression and the function of
Albert Job et al.
Scientific reports, 10(1), 18924-18924 (2020-11-05)
Inhibition of the kinase ATR, a central regulator of the DNA damage response, eliminates subsets of cancer cells in certain tumors. As previously shown, this is at least partly attributable to synthetic lethal interactions between ATR and POLD1, the catalytic
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU131101-20UG | 04061828683116 |
| EHU131101-50UG | 04061828457977 |