Skip to Content
MilliporeSigma

EHU118481

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCE

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTTTGGCAAGGTCATGTTGGCAGAACTCAAGGGCAAAGATGAAGTATATGCTGTGAAGGTCTTAAAGAAGGACGTCATCCTTCAGGATGATGACGTGGACTGCACAATGACAGAGAAGAGGATTTTGGCTCTGGCACGGAAACACCCGTACCTTACCCAACTCTACTGCTGCTTCCAGACCAAGGACCGCCTCTTTTTCGTCATGGAATATGTAAATGGTGGAGACCTCATGTTTCAGATTCAGCGCTCCCGAAAATTCGACGAGCCTCGTTCACGGTTCTATGCTGCAGAGGTCACATCGGCCCTCATGTTCCTCCACCAGCATGGAGTCATCTACAGGGATTTGAAACTGGACAACATCCTTCTGGATGCAGAAGGTCACTGCAAGCTGGCTGACTTCGGGATGTGCAAGGAAGGGATTCTGAATGGTGTGACGACCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomoyuki Nishizaki
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(5), 1985-1998 (2018-05-04)
Phosphatidylethanolamine, a component of the plasma membrane, regulates diverse cellular processes. The present study investigated the role of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) in the trafficking of the glucose transporter GLUT4 and the glucose homeostasis. Monitoring of GLUT4 trafficking, GLUT4 internalization assay, and
Hui Wang et al.
Cell death & disease, 8(5), e2770-e2770 (2017-05-12)
Gallbladder cancer (GBC) is one of the most common malignancy of the biliary tract characterized by its high chemoresistant tendency. Although great progresses have been made in recent decades for treating many cancers with anticancer drugs, effective therapeutics methods for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service