Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGACTGCTGGAGTTAATACCACCGACAAAGAGATGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuanxia Huang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 41-46 (2016-12-09)
Cartilage degeneration is known as a major cause of osteoarthritis (OA). C1q/TNF-related protein-3 (CTRP3) is an adipokine relative to chondrogenesis in vitro. However, its effect on cartilage degeneration in OA remains unclearly. In the present study, SW1353 cells were treated
Hidenori Kitai et al.
Cancer discovery, 6(7), 754-769 (2016-05-08)
KRAS is frequently mutated in lung cancer. Whereas MAPK is a well-known effector pathway of KRAS, blocking this pathway with clinically available MAPK inhibitors is relatively ineffective. Here, we report that epithelial-to-mesenchymal transition rewires the expression of receptor tyrosine kinases
Jiexia Zhang et al.
International journal of oncology, 54(6), 2211-2221 (2019-04-04)
Emerging reports have revealed that several microRNAs (miRNAs) are abnormally expressed in non‑small cell lung cancer (NSCLC). miRNAs have been identified as oncogenes or tumor suppressors, and regulate various biological processes including oncogenesis and development. miR‑802 is dysregulated in multiple
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU100421-20UG | 04061831357097 |
| EHU100421-50UG | 04061828367030 |