EHU098921
MISSION® esiRNA
targeting human FAAH
Sign Into View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCGAGGTGTACCGCAAAACCGTGATTGCCCAGTGGAGGGCGCTGGACCTGGATGTGGTGCTGACCCCCATGCTGGCCCCTGCTCTGGACTTGAATGCCCCAGGCAGGGCCACAGGGGCCGTCAGCTACACTATGCTGTACAACTGCCTGGACTTCCCTGCAGGGGTGGTGCCTGTCACCACGGTGACTGCTGAGGACGAGGCCCAGATGGAACATTACAGGGGCTACTTTGGGGATATCTGGGACAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FAAH(2166), FAAH(2166)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Janani Ravi et al.
Oncotarget, 5(9), 2475-2486 (2014-05-09)
The endocannabinoid anandamide (AEA), a neurotransmitter was shown to have anti-cancer effects. Fatty acid amide hydrolase (FAAH) metabolizes AEA and decreases its anti-tumorigenic activity. In this study, we have analyzed the role of FAAH inhibition in non-small cell lung cancer
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service