Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCTTGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGTTTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAGCTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCTGCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAGACGGGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ran Wei et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(9), 1952-1964 (2020-03-13)
While amplified expressed cyclin E1 is a well-known tumorigenic factor and prognostic biomarker in several malignancies, its prognostic predictive potential and function in osteosarcoma is poorly understood. Here we reveal discrete expression pattern, correlation to clinicopathological characteristics and prognosis and
Caishang Zheng et al.
Scientific reports, 7(1), 16422-16422 (2017-11-29)
Enterovirus 71 (EV71) is the predominant causative pathogen of hand-foot-and-mouth disease (HFMD). Contrary to other HFMD-causing enterovirus, EV71 can lead to severe neurological complications, even death. MicroRNAs (miRNAs) are small non-coding RNAs that constitute the largest family of gene regulators
X Zhang et al.
Neoplasma, 66(5), 704-716 (2019-05-28)
Previous studies have reported that miR-107 could be utilized as a potential peripheral biomarker in prostate cancer (PCa). However, the specific functions of miR-107 in prostate cancer and its relevant mechanisms are still unknown. The aim of this research was
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU070111-20UG | 04061831352337 |
| EHU070111-50UG | 04061831372625 |