Skip to Content
MilliporeSigma

EHU057451

Sigma-Aldrich

MISSION® esiRNA

targeting human TOP2B

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTTAGCGGCATTTGTTGAAGAACTGGATAAAGTGGAATCTCAAGAACGAGAAGATGTTCTGGCTGGAATGTCTGGAAAAGCAATTAAAGGTAAAGTTGGCAAACCTAAGGTGAAGAAACTCCAGTTGGAAGAGACAATGCCCTCACCTTATGGCAGAAGAATAATTCCTGAAATTACAGCTATGAAGGCAGATGCCAGCAAAAAGTTGCTGAAGAAGAAGAAGGGTGATCTTGATACTGCAGCAGTAAAAGTGGAATTTGATGAAGAATTCAGTGGAGCACCAGTAGAAGGTGCAGGAGAAGAGGCATTGACTCCATCAGTTCCTATAAATAAAGGTCCCAAACCTAAGAGGGAGAAGAAGGAGCCTGGTACCAGAGTGAGAAAAACACCTACATCATCTGGTAAACCTAGTGCAAAGAAAGTGAAGAAACGGAATCCTTGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stefan Hatzl et al.
Cancers, 12(2) (2020-02-26)
Resistance to chemotherapy is one of the primary obstacles in acute myeloid leukemia (AML) therapy. Micro-RNA-23a (miR-23a) is frequently deregulated in AML and has been linked to chemoresistance in solid cancers. We, therefore, studied its role in chemoresistance to cytarabine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service