Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAAAGGTTTTTTCCCCCCTTACTATTTCCTTGGTGCCAATTCCAAGTTGCTCTCGCAGCAGCAAATTTATGAATGGTTTGTCTTGATCAAGAACAAAGAATTCATTCCCACCATTCTCATATATACTACTTGTCTCTTCTAAGCTACTGCATCTATGTTTGACAGTCTGGAATGTTTAAACCCATTCCTGCTCTCTCTTTTATATGTGAATCATTGTTTCATTGGCTAAAATATAAACATATTGTTGAAAGATGATTTGAGAAAAATAGGAAGGACTGGGAGGCAGGGAAGAGTACCAACAACCTCAACTGCCTACTCAAAGGTGATGATGTCATACAAAGGGAAGAGATTCAGGTTACGGCCATTTGTTTAGGGGCATGAAGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CAV1(12389), Cav1(12389)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Emily J Guggenheim et al.
Nanotoxicology, 14(4), 504-532 (2020-02-11)
Engineered Nanomaterials (NMs), such as Superparamagnetic Iron Oxide Nanoparticles (SPIONs), offer significant benefits in a wide range of applications, including cancer diagnostic and therapeutic strategies. However, the use of NMs in biomedicine raises safety concerns due to lack of knowledge
Jing Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(4), 1289-1300 (2015-10-03)
Pulmonary microvascular endothelial cell (PMVEC) proliferation and angiogenesis contribute to the development of hepatopulmonary syndrome (HPS). MicroRNA-199a-5p (miR-199a-5p) has emerged as a potent regulator of angiogenesis, and its expression levels significantly decrease in the serum of patients with hepatopathy. However
Carmen Juks et al.
Biochimica et biophysica acta, 1848(12), 3205-3216 (2015-09-27)
Cell penetrating peptides are efficient tools to deliver various bioactive cargos into cells, but their exact functioning mechanism is still debated. Recently, we showed that a delivery peptide PepFect14 condenses oligonucleotides (ON) into negatively charged nanocomplexes that are taken up
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU013051-20UG | 04061831337556 |
| EMU013051-50UG | 04061831368703 |