Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chang-Sook Hong et al.
Journal of extracellular vesicles, 9(1), 1800979-1800979 (2020-09-19)
Most patients with acute myeloid leukaemia (AML) experience disease recurrence after chemotherapy largely due to the development of drug resistance. Small extracellular vesicles (sEVs) are known to play a significant role in leukaemia drug resistance by delivery of anti-apoptotic proteins
Olöf Bjarnadottir et al.
Scientific reports, 10(1), 558-558 (2020-01-19)
Statins, commonly used to treat hypercholesterolemia, have also been proposed as anti-cancer agents. The identification of a predictive marker is essential. The 3-hydroxy-3-methylglutaryl-coenzyme-A reductase (HMGCR), which is inhibited by statins, might serve as such a marker. Thorough antibody validation was
Jiajun Huang et al.
EBioMedicine, 45, 251-260 (2019-06-16)
Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive. In this study, we investigated the potential contribution and molecular mechanism of increased lactate production to SAMS
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU079561-20UG | 04061828630417 |
| EHU079561-50UG | 04061828402953 |