Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAAGACGGTCTCCACGATATTCCTGGTGGTTGTCCTCTATCTGATCATCGGAGCCACCGTGTTCAAAGCATTGGAGCAGCCTCATGAGATTTCACAGAGGACCACCATTGTGATCCAGAAGCAAACATTCATATCCCAACATTCCTGTGTCAATTCGACGGAGCTGGATGAACTCATTCAGCAAATAGTGGCAGCAATAAATGCAGGGATTATACCGTTAGGAAACACCTCCAATCAAATCAGTCACTGGGATTTGGGAAGTTCCTTCTTCTTTGCTGGCACTGTTATTACAACCATAGGATTTGGAAACATCTCACCACGCACAGAAGGCGGCAAAATATTCTGTATCATCTATGCCTTACTGGGAATTCCCCTCTTTGGTTTTCTCTTGGCTGGAGTTGGAGATCAGCTAGGCACCATATTTGGAAAAGGAATTGCCAAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Oleg Yarishkin et al.
Investigative ophthalmology & visual science, 60(6), 2294-2303 (2019-05-23)
The concentration of protons in the aqueous humor (AH) of the vertebrate eye is maintained close to blood pH; however, pathologic conditions and surgery may shift it by orders of magnitude. We investigated whether and how changes in extra- and
Haiyun Guo et al.
BMC anesthesiology, 17(1), 124-124 (2017-09-06)
There are growing concerns that anaesthetic exposure can cause extensive apoptotic degeneration of neurons and the impairment of normal synaptic development and remodelling. However, little attention has been paid to exploring the possible cytotoxicity of inhalation anaesthetics, such as isoflurane
Ricardo H Pineda et al.
American journal of physiology. Renal physiology, 313(2), F535-F546 (2017-05-26)
Detrusor overactivity (DO) is the abnormal response of the urinary bladder to physiological stretch during the filling phase of the micturition cycle. The mechanisms of bladder smooth muscle compliance upon the wall stretch are poorly understood. We previously reported that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU058031-20UG | 04061828560486 |
| EHU058031-50UG | 04061828315147 |