Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sarah Ouahoud et al.
Oncogene, 39(12), 2453-2466 (2020-01-25)
Patients with the mesenchymal subtype colorectal cancer (CRC) have a poor prognosis, in particular patients with stroma-rich tumors and aberrant SMAD4 expression. We hypothesized that interactions between SMAD4-deficient CRC cells and cancer-associated fibroblasts provide a biological explanation. In transwell invasion
Weijie Yang et al.
Journal of cellular biochemistry, 120(12), 19684-19690 (2019-08-23)
miR-129-5p is implicated in many diseases, such as laryngeal cancer and breast cancer. In this study, we studied the mechanism underlying the role of BMP2 in intervertebral disc degeneration (IDD). We used a luciferase assay system to determine the relationship
Long Yu et al.
Biochemical and biophysical research communications, 516(2), 546-550 (2019-06-27)
Circular RNAs (circRNAs) are emerging as important regulators in human disease. The expression profile and mechanism of circRNAs in postmenopausal osteoporosis remains largely unknown. Bone morphogenetic protein 2 (BMP2) is known to play important role in inducing osteogenic differentiation. MiR-98
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU013931-20UG | 04061831361841 |
| EHU013931-50UG | 04061828450237 |