Skip to Content
Merck

EMU183581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nanog

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCCTAGTTCTGAGGAAGCATCGAATTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGCTCTGCACAGAGGCTGCCTCTCCTCGCCCTTCCTCTGAAGACCTGCCTCTTCAAGGCAGCCCTGATTCTTCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCCTGAGGAGGAGGAGAACAAGGTCCTTGCCAGGAAGCAGAAGATGCGGACTGTGTTCTCTCAGGCCCAGCTGTGTGCACTCAAGGACAGGTTTCAGAAGCAGAAGTACCTCAGCCTCCAGCAGATGCAAGAACTCTCCTCCATTCTGAACCTGAGCTATAAGCAGGTTAAGACCTGGTTTCAAAACCAAAGGATGAAGTGCAAGCGGTGGCAGAAAAACCAGTGGTTGAAGACTAGCAATGGTCTGATTCAGAAGGGCTCAGCACCAGTGGAGTATCCCAGCATCCATTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Despina Bazou et al.
Ultrasound in medicine & biology, 37(2), 321-330 (2011-01-07)
In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Khalid Arif et al.
OncoTargets and therapy, 8, 1327-1334 (2015-06-18)
There is an accumulation of evidence that shows a significant role of cancer stem cells in tumor initiation, proliferation, relapse, and metastasis. Nanog is the most important core transcription marker of stem cells, known by its role in maintaining pluripotency

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service