Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGCATTCAAACCTCTCGTGAAGTTGGAAAGGCTTTACCTGTCTAAGAACCAACTAAAGGAACTGCCTGAAAAAATGCCCAGAACTCTCCAGGAACTTCGTGTCCATGAGAATGAGATCACCAAGCTGCGGAAATCCGACTTCAATGGACTGAACAATGTGCTTGTCATAGAACTGGGCGGCAACCCACTGAAAAACTCTGGGATTGAAAACGGAGCCTTCCAGGGACTGAAGAGTCTCTCATACATTCGCATCTCAGACACCAACATAACTGCGATCCCTCAAGGTCTGCCTACTTCTCTCACTGAAGTGCATCTAGATGGCAACAAGATCACCAAGGTTGATGCACCCAGCCTGAAAGGACTGATTAATTTGTCTAAACTGGGATTGAGCTTCAACAGCATCACCGTTATGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... DCN(13179), Dcn(13179)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yoshihiro Joshua Ono et al.
The Journal of endocrinology, 223(2), 203-216 (2014-09-24)
Dienogest, a synthetic progestin, has been shown to be effective against endometriosis, although it is still unclear as to how it affects the ectopic endometrial cells. Decorin has been shown to be a powerful endogenous tumor repressor acting in a
Agnes D Berendsen et al.
Matrix biology : journal of the International Society for Matrix Biology, 35, 223-231 (2014-01-01)
Matrix proteoglycans such as biglycan (Bgn) dominate skeletal tissue and yet its exact role in regulating bone function is still unclear. In this paper we describe the potential role of (Bgn) in the fracture healing process. We hypothesized that Bgn
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU065331-20UG | 04061828492152 |
| EMU065331-50UG | 04061828266869 |