Skip to Content
Merck

EMU041951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdcd4

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATCTTATGTAATACCTATATCGATAGTTACAAAGGAACTGTAGATTGTGTACAGGCTCGAGCTGCTCTGGATAAGGCTACTGTGCTCCTGAGTATGTCCAAAGGCGGGAAGCGGAAAGACAGTGTGTGGGGATCTGGAGGCGGGCAACAGCCTGTCAATCACCTTGTTAAAGAGATTGATATGCTGCTTAAAGAGTATTTACTCTCTGGAGATATATCTGAAGCTGAACACTGCCTTAAGGAACTGGAAGTACCTCATTTTCACCACGAGCTTGTATATGAAGCCATTATAATGGTTTTAGAGTCAACTGGAGAAAGTGCATTCAAGATGATCTTAGATTTATTAAAATCCTTGTGGAAGTCTTCTACTATTACCATAGACCAAATGAAAAGGGGCTATGAGAGAATTTACAATGAAATCCCAGACATTAATCTGGATGTCCCGCACTCATACTCTGTTCTTGAGAGATTTGTGGAGGAATGTTTTCAGGCTGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiang Su et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1426-1433 (2015-03-15)
The aim of this study was to investigate the role of the programmed cell death factor 4 (PDCD4)/nuclear factor-κB (NF-κB) signaling pathway in coronary micro-embolism (CME)-induced inflammatory responses and cardiac dysfunction in a porcine model. Bama miniature pigs were randomly
Chuankui Wei et al.
Oncology reports, 34(1), 211-220 (2015-06-13)
Numerous studies have demonstrated that microRNAs (miRNAs) play vital roles in papillary thyroid carcinoma (PTC). The aim of the present study was to examine the expression levels of miR-183 in PTC and investigate whether its potential roles involved targeting the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service