Skip to Content
Merck

EMU020501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bag3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAATTGATGTCCCAGGTCAAGTACAAGTCTATGAACTCCAGCCCAGCAACCTTGAGGCCGAGCAGCCACTCCAGGAAATCATGGGTGCCGTGGTAGCCGACAAGGATGAGAAAGGTCCTGAAAACAAAGATCCACAAACTGAAAGCCAACAGCTAGAAGCCAAAGCAGCCACACCTCCAAATCCCAGCAACCCAGCAGACTCAGCTGGCAACCTGGTGGCTCCCTAGTGTCCCCTGGGACCATGCTGTAGAGACTTTTAAGTTGCATGCACTGCGGGACTTGCAGTCAGCTGGCTGCCATTATTCATAGCCACTTGGTATGCAGTAACTTGGGGTGGAGGTAAAACACTAACAAAGGGGGCTTTTCTTCCATAGTCTATTCTGTATAAATAATAAGTTGCCTGTTCCAGAAGTCTAACCCTAACCCCTCTGGTTGTCTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Georg Karpel-Massler et al.
Oncotarget, 6(16), 14507-14521 (2015-05-27)
Despite great efforts taken to advance therapeutic measures for patients with glioblastoma, the clinical prognosis remains grim. The antiapoptotic Bcl-2 family protein Mcl-1 is overexpressed in glioblastoma and represents an important resistance factor to the BH-3 mimetic ABT263. In this
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Young-Hee Jin et al.
Biochemical and biophysical research communications, 464(2), 561-567 (2015-07-15)
Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service