Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGCCAACTCGTTTGTAGGGACGCGCTCCTACATGTCCCCAGAGCGGCTGCAGGGCACCCACTACTCTGTGCAGTCGGACATCTGGAGCATGGGGCTGTCGCTGGTGGAGCTGGCCATCGGGAGGTATCCCATTCCCCCACCTGATGCCAAGGAACTAGAGGCCAGCTTTGGCCGGCCTGTGGTGGACGGGGCAGACGGAGAACCCCATAGTGTCTCCCCGAGGCCCAGGCCCCCTGGACGCCCCATCAGTGTAGGTCATGGGATGGACAGCCGACCGGCCATGGCCATCTTTGAGCTGCTGGACTACATAGTGAACGAGCCACCTCCCAAGCTGCCCAGTGGTGTGTTCAGCTCAGACTTCCAGGAGTTTGTGAATAAATGTCTCATTAAGAACCCAGCAGAGCGAGCAGATCTGAAGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... MAP2K2(26396), Map2k2(26396)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Simona Gargiulo et al.
International journal of molecular sciences, 13(11), 14278-14293 (2012-12-04)
The hypercholesterolemia-atherosclerosis association is now established; hypercholesterolemia may induce vascular-cell activation, subsequently increasing expression of adhesion molecules, cytokines, chemokines, growth factors, and other key inflammatory molecules. Among inflammatory molecules expressed by vascular cells, integrins play a critical role in regulating
Sara Alves et al.
Oncotarget, 6(31), 30787-30802 (2015-09-30)
The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation
Caroline N Mills et al.
Molecular cancer, 8, 104-104 (2009-11-19)
Hypoxia inducible factor-1 alpha (HIF-1alpha) protein is rapidly degraded under normoxic conditions. When oxygen tensions fall HIF-1alpha protein stabilizes and transactivates genes involved in adaptation to hypoxic conditions. We have examined the normoxic expression of HIF-1alpha RNA and protein in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU011371-20UG | 04061831368598 |
| EMU011371-50UG | 04061828441105 |