Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAGCATCTGAGCCTTTAGGAAGCAGCAAAGAGGAATTCTCTGCCCAGTGGCATGCCATGTTGCTTTCAGGCCTCTCCCATGCTTGTCTATGTTCAGACGTGCATCTCATCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAATTGTACTTGTGTCATTTTTAATATCATTGTCTTTATCACTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTCTGTTCATCAAACACATGCCAGGCTGAACTACAGTGAAACCCTAGTGACCTGGGTGGTCGTTCTTACTGATGTTTGCACTGCTGTTCATCGTGACTCACTAGCTGGCTGCCTGTATTGTCAGGATTCTCGGACCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCTGAGAGGGAGCCTTGTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... MAP2K1(26395), Map2k1(26395)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
Map2k1 (dual specificity mitogen-activated protein kinase kinase 1) is a serine threonine kinase and is required for ERK (extracellular-signal-regulated kinase) activation. Activation of ERK is associated with production of IL-10 (interleukin 10) and IL-12. Absence of the Map2k1 gene results in embryonic lethality. Map2k1 is responsible for the stimulation of epidermal proliferation, regulating cell migration in fibroblasts. Deficiency of Map2k1 protein causes lupus-like syndrome.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jui-Tai Chen et al.
Toxicology, 339, 40-50 (2015-12-15)
Glutamate can activate NMDA receptor (NMDAR) and subsequently induces excitotoxic neuron loss. However, roles of NMDARs in the blood-brain barrier (BBB) are little known. This study used a mouse cerebrovascular endothelial cell (MCEC) model to evaluate the effects of NMDAR
Mohamad Bouhamdan et al.
Cellular signalling, 27(10), 2068-2076 (2015-07-26)
The mitogen activated protein kinases ERK1/2 play an important role in response to toll like receptor (TLR) activation and cytokine production, including IL-10 and IL-12. Here, we examined the role of MEK1 in ERK1/2 activation in response to TLR4 agonist
LIM-only protein FHL2 critically determines survival and radioresistance of pancreatic cancer cells.
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU010641-20UG | 04061831368543 |
| EMU010641-50UG | 04061828440412 |