Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PKM(5315), PKM2(5315)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Pu-Hyeon Cha et al.
British journal of cancer, 124(3), 634-644 (2020-10-20)
Most cancer cells employ the Warburg effect to support anabolic growth and tumorigenesis. Here, we discovered a key link between Warburg effect and aberrantly activated Wnt/β-catenin signalling, especially by pathologically significant APC loss, in CRC. Proteomic analyses were performed to
Hai Hu et al.
Journal of Cancer, 11(8), 2022-2031 (2020-03-05)
Macrophages play a critical role in the initiation and progression in various human solid tumors; however, their role and transformation in pancreatic ductal adenocarcinoma (PDAC) were still illusive. Here, immunohistochemistry was used to determine CD206 (specific marker of M2 macrophage)
Yong Liu et al.
Oncotarget, 8(43), 75206-75216 (2017-11-02)
Platinum-based chemotherapeutic drugs are irreplaceable for the treatment of advanced non-small cell lung cancer (NSCLC). However, acquired drug resistance has become a major obstacle for the clinical application of chemotherapy on NSCLC. In the present study, we established carboplatin-resistant NSCLC
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147561-50UG | 04061828427444 |
| EHU147561-20UG | 04061831366020 |