Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGACCACGTATCCCACTTGGAGAATGTGTCAGAGGATGAGATAAACCGACTGCTGGGGATGGTGGTGGATGTGGAGAATCTCTTCATGTCTGTTCACAAGGAAGAGGACACAGACACCAAGCAGGTCTATTTCTACCTCTTCAAGCTACTGCGGAAATGCATCCTGCAGATGACCCGGCCTGTGGTGGAGGGGTCCCTGGGCAGCCCTCCATTTGAGAAACCTAATATTGAGCAGGGTGTGCTGAACTTTGTGCAGTACAAGTTTAGTCACCTGGCTCCCCGGGAGCGGCAGACGATGTTCGAGCTCTCAAAGATGTTCTTGCTCTGCCTTAACTACTGGAAGCTTGAGACACCTGCCCAGTTTCGGCAGAGGTCTCAGGCTGAGGACGTGGCTACCTACAAGGTCAATTACACCAGATGGCTCTGTTACTGCCACGTGCCCCAGAGCTGTGATAGCCTCCCCCGCTACGAAACCACTCATGTCTTTGGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Liming Zhao et al.
Oncology letters, 16(3), 3955-3963 (2018-08-22)
Histone acetyltransferase GCN5 is a critical component of the TGF-β/Smad signaling pathway in breast cancer cells; however, it remains unknown whether it is involved in the development and progression of breast cancer. The present study investigated the role of GCN5
Lijun Qiao et al.
Journal of cellular and molecular medicine, 22(11), 5333-5345 (2018-08-07)
General control nondepressible 5 (GCN5), the first identified transcription-related lysine acetyltransferase (KAT), is an important catalytic component of a transcriptional regulatory SAGA (Spt-Ada-GCN5-Acetyltransferase) and ATAC (ADA2A-containing) complex. While GCN5 has been implicated in cancer development, its role in cervical cancer
Kun Liu et al.
International journal of molecular sciences, 16(9), 21897-21910 (2015-09-18)
The general control of nucleotide synthesis 5 (GCN5), which is one kind of lysine acetyltransferases, regulates a number of cellular processes, such as cell proliferation, differentiation, cell cycle and DNA damage repair. However, its biological role in human glioma development
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU142761-20UG | 04061831365344 |
| EHU142761-50UG | 04061828415496 |