Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTGTTTCAACAGAGGGAGTTTAATACAGGAAATTGACTTACATAGATGATAAAAGAGAAGCCAAACAGCAAGAAGCTGTTACCACACCCAGGGCTATGAGGATAATGGGAAGAGGTTTGGTTTCCTGTGTCCAGTAGTGGGATCATCCAGAGGAGCTGGAACCATGGTGGGGGCTGCCTAGTGGGAGTTAGGACCACCAATGGATTGTGGAAAATGGAGCCATGACAAGAACAAAGCCACTGACTGAGATGGAGTGAGCTGAGACAGATAAGAGAATACCTTGGTCTCACCTATCCTGCCCTCACATCTTCCACCAGCACCTTACTGCCCAGGCCTATCTGGAAGCCACCTCACCAAGGACCTTGGAAGAGCAAGGGACAGTGAGGCAGGAGAAGAACAAGAAATGGATGTAAGCCTGGCCCATAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ri Cui et al.
Oncotarget, 6(26), 21802-21815 (2015-08-27)
We recently reported that miR-224 was significantly up-regulated in non-small cell lung cancer (NSCLC) tissues, in particular in resected NSCLC metastasis. We further demonstrated that miR-224 functions as an oncogene in NSCLC by directly targeting TNFAIP1 and SMAD4. However, the
Woo Jin Jeong et al.
PloS one, 7(9), e45754-e45754 (2012-10-11)
In addition to its well-characterized role in the lens, αB-crystallin performs other functions. Methylglyoxal (MGO) can alter the function of the basement membrane of retinal pigment epithelial (RPE) cells. Thus, if MGO is not efficiently detoxified, it can induce adverse
Xiujin Shen et al.
Cell death & disease, 12(2), 186-186 (2021-02-17)
Chemotherapy drug-induced nephrotoxicity limits clinical applications for treating cancers. Pyroptosis, a newly discovered programmed cell death, was recently reported to be associated with kidney diseases. However, the role of pyroptosis in chemotherapeutic drug-induced nephrotoxicity has not been fully clarified. Herein
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU090761-20UG | 04061828595914 |
| EHU090761-50UG | 04061828360550 |