Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTGAACTCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cheng-Fang Tsai et al.
Toxicology and applied pharmacology, 338, 182-190 (2017-11-29)
Connexins are widely supported as tumor suppressors due to their downregulation in cancers, nevertheless, more recent evidence suggests roles for connexins in facilitating tumor progression in later stages, including metastasis. One of the key factors regulating the expression, modification, stability
Feng He et al.
Journal of translational medicine, 17(1), 335-335 (2019-10-06)
The P38 mitogen-activated protein kinase (MAPK) pathway plays an essential role in CVB3-induced diseases. We previously demonstrated microRNA-21 has potential inhibitory effect on the MAP2K3 which locates upstream of P38 MAPK and was upregulated in mouse hearts upon CVB3 infection.
Jing Wang et al.
Cell transplantation, 29, 963689720938023-963689720938023 (2020-07-02)
Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease. New evidence suggested that linc02381 suppressed colorectal cancer progression by regulating PI3 K signaling pathway, but the role of linc02381 in other diseases, such as RA, remains unclear. This study aimed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU088281-50UG | 04061828397655 |
| EHU088281-20UG | 04061828623419 |