Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Michaela Ohmer et al.
Cell death & disease, 7(8), e2340-e2340 (2016-08-19)
Infection of mammalian cells with viruses often induces apoptosis. How the recognition of viruses leads to apoptosis of the infected cell and which host cell factors regulate this cell death is incompletely understood. In this study, we focussed on two
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU079921-20UG | 04061831353617 |
| EHU079921-50UG | 04061831373356 |