Skip to Content
Merck

EHU076601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA4

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGACCTGAATGAGGAGGAAACCATTCTCATCATCCGGCGTCTCCACAAAGTGCTGCGGCCCTTCTTGCTCCGACGACTCAAGAAGGAAGTCGAGGCCCAGTTGCCCGAAAAGGTGGAGTACGTCATCAAGTGCGACATGTCTGCGCTGCAGCGAGTGCTCTACCGCCACATGCAGGCCAAGGGCGTGCTGCTGACTGATGGCTCCGAGAAGGACAAGAAGGGCAAAGGCGGCACCAAGACCCTGATGAACACCATCATGCAGCTGCGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATCGAGGAGTCCTTTTCCGAGCACTTGGGGTTCACTGGCGGCATTGTCCAAGGGCTGGACCTGTACCGAGCCTCGGGTAAATTTGAGCTTCTTGATAGAATTCTTCCCAAACTCCGAGCAACCAACCACAAAGTGCTGCTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tatiana Souslova et al.
Molecular neurobiology, 54(10), 8263-8277 (2016-12-04)
Five-prime repressor element under dual repression binding protein-1 (Freud-1)/CC2D1A is genetically linked to intellectual disability and implicated in neuronal development. Freud-1 represses the serotonin-1A (5-HT1A) receptor gene HTR1A by histone deacetylase (HDAC)-dependent or HDAC-independent mechanisms in 5-HT1A-negative (e.g., HEK-293) or
Wentao Sun et al.
European journal of pharmacology, 875, 173038-173038 (2020-02-28)
High glucose (HG)-induced oxidative damage of retinal ganglion cells (RGCs) contributes to the pathogenesis of diabetic retinopathy, a severe complication of diabetes mellitus. Brahma-related gene 1 (Brg1) has currently emerged as a cytoprotective protein that alleviates oxidative damage induced by
Afzal Husain et al.
Nature communications, 7, 10549-10549 (2016-02-05)
Topoisomerase 1, an enzyme that relieves superhelical tension, is implicated in transcription-associated mutagenesis and genome instability-associated with neurodegenerative diseases as well as activation-induced cytidine deaminase. From proteomic analysis of TOP1-associated proteins, we identify SMARCA4, an ATP-dependent chromatin remodeller; FACT, a
Yanru Li et al.
Journal of biochemical and molecular toxicology, 32(4), e22044-e22044 (2018-02-20)
Accumulating evidence has reported that microRNA-144-3p (miR-144-3p) is highly related to oxidative stress and apoptosis. However, little is known regarding its role in cerebral ischemia/reperfusion-induced neuronal injury. Herein, our results showed that miR-144-3p expression was significantly downregulated in neurons following
Tess Orvis et al.
Cancer research, 74(22), 6486-6498 (2014-08-15)
SWI/SNF chromatin remodeling complexes regulate critical cellular processes, including cell-cycle control, programmed cell death, differentiation, genomic instability, and DNA repair. Inactivation of this class of chromatin remodeling complex has been associated with a variety of malignancies, including lung, ovarian, renal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service