Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Osamu Otabe et al.
Oncology reports, 37(1), 98-104 (2016-11-15)
In alveolar rhabdomyosarcoma (ARMS) that is a highly malignant pediatric soft tissue tumor, MET, a receptor of hepatocyte growth factor (HGF), was reported to be downstream of the PAX3-FOXO1 fusion gene specific to ARMS, and a key mediator of metastatic
Yunching Chen et al.
Scientific reports, 7, 44123-44123 (2017-03-10)
Sorafenib is a RAF inhibitor approved for several cancers, including hepatocellular carcinoma (HCC). Inhibition of RAF kinases can induce a dose-dependent "paradoxical" upregulation of the downstream mitogen-activated protein kinase (MAPK) pathway in cancer cells. It is unknown whether "paradoxical" ERK
MiR-143 regulates proliferation and apoptosis of myelocytic leukemia cell HL-60 via modulating ERK1.
B Song et al.
European review for medical and pharmacological sciences, 22(11), 3333-3341 (2018-06-20)
Extracellular signal-regulated kinase (ERK)/mitogen activated protein kinase (MAPK) signaling pathway is widely involved in cell proliferation and invasion regulation. Enhanced expression or function of ERK1 is important for leukemia. Abnormal down-regulation of microRNA (miR)-143 is correlated with leukemia pathogenesis, indicating
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU062481-20UG | 04061831351026 |
| EHU062481-50UG | 04061831372144 |