Skip to Content
Merck

EHU058421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L2

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACAAGTGCAGGAGTGGATGGTGGCCTACCTGGAGACGCAGCTGGCTGACTGGATCCACAGCAGTGGGGGCTGGGCGGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGTCTGCGGGAGGGGAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTAACTGTAGGGGCCTTTTTTGCTAGCAAGTGAAAGTCCAGGGCCAGGTGGGGCTAGGTGTGGCTGGGGGCCAGGAGAGCAGGAACAGAACAGAGAAATGCCCTTGGAAGAAGTGGAGTTGGTGGATGGGTGGGCATGGAACAGGATGGGCAGAGAAAGGGTAGTGTGTGAGGGAGCTGAGTAGGCCAGGTAGGCGATTGGAAGAGTGAGCAGGACACAGAGGGGAGGGGAATGTTTTGGCAAGTTTAGGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Clare M Adams et al.
The Journal of clinical investigation, 127(2), 635-650 (2017-01-18)
Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell
L Fang et al.
European review for medical and pharmacological sciences, 21(13), 3069-3074 (2017-07-26)
Lung cancer seriously threats to patient's life and health. Cyramza is a therapeutic drug for inhibition of vessel formation and growth in clinical practice. The aim of this study was to investigate the effect of cyramza on growth and apoptosis
Si-Hong Liu et al.
International journal of biological sciences, 16(6), 935-946 (2020-03-07)
Lymphoma is a malignant disease of the hematopoietic system that typically affects B cells. The up-regulation of miR-148b is associated with radiosensitization in B-cell lymphoma (BCL). This study aimed to explore the role of miR-148b in regulating the radiosensitivity of
Hyun Joo Chung et al.
Oncotarget, 6(21), 18429-18444 (2015-07-15)
Glioblastoma multiforme (GBM) is the most common malignant brain tumor and exhibits aggressive and invasive behavior. We previously identified four miRNAs-miR-29b, 494, 193a-3p, and 30e-with enhanced expression in GBM following treatment of ionizing radiation by miRNA microarray analysis. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service