설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGCAGATATGCTGAAGCTCCGGTCACTTAGTGAGGGGCCTCCCAAGGAGCTGAAGATCAGGCTCATCAAGGTGGAAAGTGGGGACAAGGAGACCTTTATCGCCTCTGAGGTGGAAGAGCGGCGGCTGCGCATGGCAGACCTCACCATCAGCCACTGTGCCGCCGATGTCATGCGTGCCAGCAAGAATGCCAAGGTGAAAGGGAAATTCCGAGAGTCCTACCTGTCCCCTGCCCAGTCTGTGAAACCCAAGATCAACACTGAGGAGAAGCTGCCCCGGGAAAAACTCAACCCCCCTACCCCCAGCATCTATTTGGAGAGCAAACGAGATGCCTTCTCGCCGGTCCTGCTACAGTTCTGTACAGACCCCCGGAACCCCATCACCGTCATCAGGGGCCTGGCTGGTTCACTTCGGCTCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... KDM6B(216850), Kdm6b(216850)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jianchun Wu et al.
Oncology reports, 34(1), 455-460 (2015-05-23)
Mammary stem cells (MSCs) are the progenitor population for human breast epithelia. MSCs give rise during mammary gland development to estrogen receptor (ER)-negative basal cells and the ER- luminal progenitor (LP) population which maintains ER+ and ER- luminal cells. The
Stephanie Dumon et al.
PloS one, 7(8), e43300-e43300 (2012-09-07)
Product of the Itga2b gene, CD41 contributes to hematopoietic stem cell (HSC) and megakaryocyte/platelet functions. CD41 expression marks the onset of definitive hematopoiesis in the embryo where it participates in regulating the numbers of multipotential progenitors. Key to platelet aggregation
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.