설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTAAGGGACCTGCAGTTGGCATTGATCTCGGCACCACCTACTCCTGTGTGGGTGTCTTCCAGCATGGAAAGGTGGAAATTATTGCCAATGACCAGGGTAACCGCACCACGCCAAGCTATGTTGCTTTCACGGACACAGAGAGATTAATTGGGGATGCGGCCAAGAATCAGGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATCGGGCGTAGGTTTGATGATGCTGTTGTTCAGTCTGATATGAAGCACTGGCCCTTCATGGTGGTGAATGATGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... HSPA8(15481), Hspa8(15481)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jonathan DeGeer et al.
The Journal of cell biology, 210(5), 817-832 (2015-09-02)
During development, netrin-1 is both an attractive and repulsive axon guidance cue and mediates its attractive function through the receptor Deleted in Colorectal Cancer (DCC). The activation of Rho guanosine triphosphatases within the extending growth cone facilitates the dynamic reorganization
Madhu Sudhan Ravindran et al.
PLoS pathogens, 11(8), e1005086-e1005086 (2015-08-06)
Mammalian cytosolic Hsp110 family, in concert with the Hsc70:J-protein complex, functions as a disaggregation machinery to rectify protein misfolding problems. Here we uncover a novel role of this machinery in driving membrane translocation during viral entry. The non-enveloped virus SV40
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.