콘텐츠로 건너뛰기
Merck

EMU164891

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Npm1

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGGCTGTGAACTAAAGGCTGACAAAGACTATCACTTTAAAGTGGATAATGATGAAAATGAGCACCAGTTGTCATTAAGAACGGTCAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGTAGAGGCAGAAGCAATGAACTATGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAACCAACAGTTTCCCTAGGGGGCTTTGAAATTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAGGGCCTGTGCACATTAGTGGACAGCATCTAGTAGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGAGGAGGACGTAAAACTCTTAGGCATGTCTGGAAAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAGAAAAAAGTAAAACTTGATGAAGATGATGAGGACGATGATGAGGACGATGAGGATG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and
Lingzhi Wang et al.
Oncology reports, 34(4), 2133-2141 (2015-08-12)
Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of
S Morel et al.
Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)
Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.