설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTCATGCGGTTAATTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTAGAAGCCAACCACGATTATTAATAATGTCCAACCTGTCTGACCAGCCAGGGTCCTTCTGACACTGCTCTAACAGCCCTCTCTGCACTCCACCTGACACCAGGCGCTAATTCAAAGAATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGGCTGTAACTACTTTATAACTAACATGTCCTGCCTACTTTCTGTCAACTGCAAGAACTCTGGTGAGTCACTACTTCAGAGCTTTCCTTGTTAACAGACTCCATTGCCAGAGCTCTGGGGTGGGTATTCAGTTTTTTGAAATCTTGCTCAGCCAGAAAGGCCCAAGTCCACGCAGCTGTTGCAGAGTTACAGTTCTGTGGTCTCATGTTAGTTACCTT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... RHOA(11848), Rhoa(11848)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
Anat Biran et al.
Genes & development, 29(8), 791-802 (2015-04-10)
Mammalian cells mostly rely on extracellular molecules to transfer signals to other cells. However, in stress conditions, more robust mechanisms might be necessary to facilitate cell-cell communications. Cellular senescence, a stress response associated with permanent exit from the cell cycle
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.